View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19856_low_46 (Length: 228)
Name: NF19856_low_46
Description: NF19856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19856_low_46 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 8 - 84
Target Start/End: Original strand, 3659450 - 3659526
Alignment:
| Q |
8 |
gattgtgtgtttaccattcttaacctctttgtcatatttacattctctttcactaataggcaaataacctccatgta |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3659450 |
gattgtgtgtttaccattcttaacctctttgtcatatttacattctctttcactaataggcaaataaccttcatgta |
3659526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 158 - 228
Target Start/End: Original strand, 3659983 - 3660053
Alignment:
| Q |
158 |
gtggaaactatatggtcatttactttgaaaaaatattttctattttgattttctaaattcatgttaatttt |
228 |
Q |
| |
|
|||||| |||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3659983 |
gtggaagctatatggccatttacttcgaaaaaatattttctattttgattttctaaattcatgttaatttt |
3660053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 173 - 214
Target Start/End: Complemental strand, 32189618 - 32189577
Alignment:
| Q |
173 |
tcatttactttgaaaaaatattttctattttgattttctaaa |
214 |
Q |
| |
|
|||||||||||| |||||||||||||||||| ||||| |||| |
|
|
| T |
32189618 |
tcatttactttgtaaaaatattttctattttcattttttaaa |
32189577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University