View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19857_high_25 (Length: 353)
Name: NF19857_high_25
Description: NF19857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19857_high_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 305; Significance: 1e-171; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 305; E-Value: 1e-171
Query Start/End: Original strand, 10 - 338
Target Start/End: Complemental strand, 40055913 - 40055586
Alignment:
| Q |
10 |
gcataggtggttgtgtgagtctatctccattaaactcttcgaaacacatgacatcaaatccaagcctgtaaccgcaaaccttaaacttagaagcacgcag |
109 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
40055913 |
gcataggtggttatgtgagtctatctccattaaactcttcgaaacacatgacatcaaatccaaccctgtaaccgcaaaccttaaacttagaagcacgcag |
40055814 |
T |
 |
| Q |
110 |
tttcggtgcttaatccaatccaatttgcttattgttcgttgccctctgtaattaagcatcaaattcatccatgtgagtatattgtacctaatctctcttt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40055813 |
tttcggtgcttaatccaatccaatttgcttattgttcgttgcc-tctgtaattaagcatcaaattcatccatgtgagtatattttacctaatctctcttt |
40055715 |
T |
 |
| Q |
210 |
gatttcaatgatgctattcattatgttccaccaaccctttatagtttactaatctattttcaccaaattttgataaaaatttgatctttaccctctttgc |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40055714 |
gatttcaatgatgctattcattatgttccaccaaccctttatagtttactaatctattttcaccaaattttgataaaaatttgatctttaccctctttgc |
40055615 |
T |
 |
| Q |
310 |
cacaaacccttttttcaccatgttgaatc |
338 |
Q |
| |
|
| ||||||||||||||||||||||||||| |
|
|
| T |
40055614 |
cgcaaacccttttttcaccatgttgaatc |
40055586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University