View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19857_low_36 (Length: 298)
Name: NF19857_low_36
Description: NF19857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19857_low_36 |
 |  |
|
| [»] scaffold0197 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0197 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: scaffold0197
Description:
Target: scaffold0197; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 13 - 284
Target Start/End: Original strand, 6060 - 6331
Alignment:
| Q |
13 |
cagatgacatacttcaaagaagtaattaaatatccgttttagagaagacaaatagaaatatcaagaaaaaggaaaaataattgattaacttttaccagcc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6060 |
cagatgacatacttcaaagaagtaattaaatatccgttttagagaagacaaatagaaatatcaagaaaaaggaaaaataattgattaacttttaccagcc |
6159 |
T |
 |
| Q |
113 |
aatagtggaaccctatgccactttccttcaccatattgttgtatgcatttcttaagcaagtgatcttcttcttctgtccatgcaacaccacccatctctt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6160 |
aatagtggaaccctatgccactttccttcaccatattgttgtatgcatttcttaagcaagtgatcttcttcttctgtccatgcaacaccacccatctctt |
6259 |
T |
 |
| Q |
213 |
atgaaactcttcaaccactactactttttcaccctcatattcgacccacacctgcatcttttatatatatgt |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6260 |
atgaaactcttcaaccactactactttttcaccctcatattcgacccacacctgcatcttttatatatatgt |
6331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University