View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19857_low_42 (Length: 268)
Name: NF19857_low_42
Description: NF19857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19857_low_42 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 47 - 252
Target Start/End: Original strand, 45565891 - 45566096
Alignment:
| Q |
47 |
tcaccatccttaagccaaatcacctttgctatttgtttccaaaatgcttctgcttgtgccaataatcctcccattcaaatatgtacctccttagagcgcc |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
45565891 |
tcaccatccttaagccaaatcacctttgctatttgtttccaaaatgcttctgcttgtgccaataatcctctcattcaaatatgtacctccttagagcgcg |
45565990 |
T |
|
| Q |
147 |
caatttgggaagcttgcacgctgcccctaaatctatctaactcatcccgacattcatcaatggaaacttgatacttactttggagctttcttcccggttc |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
45565991 |
caatttgggaagcttgcacgctgcccctaaatctctctaactcatcccgacattcatcaatggaaactcgatacttactttggagctttcttccccgttc |
45566090 |
T |
|
| Q |
247 |
gttcat |
252 |
Q |
| |
|
|||||| |
|
|
| T |
45566091 |
gttcat |
45566096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 47 - 108
Target Start/End: Original strand, 8179388 - 8179449
Alignment:
| Q |
47 |
tcaccatccttaagccaaatcacctttgctatttgtttccaaaatgcttctgcttgtgccaa |
108 |
Q |
| |
|
||||||||||| |||||||||||||| ||| |||| |||||||| |||||| |||||||||| |
|
|
| T |
8179388 |
tcaccatccttcagccaaatcaccttagctctttgcttccaaaacgcttcttcttgtgccaa |
8179449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University