View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19857_low_53 (Length: 235)
Name: NF19857_low_53
Description: NF19857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19857_low_53 |
 |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 28609421 - 28609641
Alignment:
| Q |
1 |
ggaggaatggttttgggaaagcaaccaaaccaggtgaccgacaataatgatgcttttgaggtgttgtagtgaagaaacaataagaataatggttggtgaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28609421 |
ggaggaatggttttgggaaagcaaccaaaccaggtgaacgacaataatgatgcttttgaggtgttgtagtgaagaaacaataagaataatggttggtgaa |
28609520 |
T |
 |
| Q |
101 |
aaagctttccaacaaaaatttgagaatgtttgagacaacactagatttctttttgtatttagatttggtacccc--------gatgctcatagtgttcca |
192 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
28609521 |
aaagctttccaacataaatttgagaatgtttgagacaacactagatttcgttttgtatttagatttggtaccccaattataggatgctcatagtgttcca |
28609620 |
T |
 |
| Q |
193 |
ttttggttacctgcagcagta |
213 |
Q |
| |
|
|||||||||||| |||||||| |
|
|
| T |
28609621 |
ttttggttacctacagcagta |
28609641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 4 - 94
Target Start/End: Complemental strand, 437480 - 437390
Alignment:
| Q |
4 |
ggaatggttttgggaaagcaaccaaaccaggtgaccgacaataatgatgcttttgaggtgttgtagtgaagaaacaataagaataatggtt |
94 |
Q |
| |
|
||||||||||||| ||||||||| ||||| |||||| |||||| |||| ||||||| ||||||||||| | ||| |||||||||||| |
|
|
| T |
437480 |
ggaatggttttggaaaagcaacccaaccatgtgaccaccaataacgatggttttgagtggttgtagtgaatgcagaatgagaataatggtt |
437390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University