View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19857_low_56 (Length: 227)
Name: NF19857_low_56
Description: NF19857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19857_low_56 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 12386721 - 12386507
Alignment:
| Q |
1 |
atgttatgactctacttttttccataattcttgtttaaatagtttatgatgatattcattttcgtaagcctccttcttgtattagggataaagattgtcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12386721 |
atgttatgactctacttttttccataattcttgtttaaatagtctatgatgatattcattttcgtaagcctccttcttgtattagggataaagattgtcc |
12386622 |
T |
|
| Q |
101 |
acaagtaaaagaatttaatgttatcgtaaaggcttttgtatagtgatcttcagttaaaactaatatgaatcggttcttctgctagcaaaagaattgtgca |
200 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12386621 |
acaagtaaaaaaaattaatgttatcgtaaaggcttttgtatagtgatcttcagttaaaactaatatgaatcggttcttctgctagcaaaagaattgtgca |
12386522 |
T |
|
| Q |
201 |
ctttagcctatgctt |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
12386521 |
ctttagcctatgctt |
12386507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 40 - 104
Target Start/End: Complemental strand, 10980598 - 10980534
Alignment:
| Q |
40 |
tagtttatgatgatattcattttcgtaagcctccttcttgtattagggataaagattgtccacaa |
104 |
Q |
| |
|
|||| |||||| |||| ||||||||||||||||| | ||||||| ||||||||||||||||||| |
|
|
| T |
10980598 |
tagtatatgattctatttattttcgtaagcctcctccatgtattacggataaagattgtccacaa |
10980534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University