View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19857_low_61 (Length: 215)
Name: NF19857_low_61
Description: NF19857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19857_low_61 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 107 - 191
Target Start/End: Original strand, 18904480 - 18904564
Alignment:
| Q |
107 |
ccgcctttcccactcccccactacacaaaccactctcttcagctcagtgagtagttttttctgtcatttcggtctgattccttcg |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
18904480 |
ccgcctttcccactcccccactacacaaaccactctcttcagctcagtgagtagttttttctgtcatttcggtttgattccttcg |
18904564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University