View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19857_low_61 (Length: 215)

Name: NF19857_low_61
Description: NF19857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19857_low_61
NF19857_low_61
[»] chr1 (1 HSPs)
chr1 (107-191)||(18904480-18904564)


Alignment Details
Target: chr1 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 107 - 191
Target Start/End: Original strand, 18904480 - 18904564
Alignment:
107 ccgcctttcccactcccccactacacaaaccactctcttcagctcagtgagtagttttttctgtcatttcggtctgattccttcg 191  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
18904480 ccgcctttcccactcccccactacacaaaccactctcttcagctcagtgagtagttttttctgtcatttcggtttgattccttcg 18904564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University