View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19858_low_13 (Length: 296)
Name: NF19858_low_13
Description: NF19858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19858_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 23 - 280
Target Start/End: Complemental strand, 34460703 - 34460436
Alignment:
| Q |
23 |
cgtttcaggcgagtcttgctgctgtttcattgctctgtctttcccactgtttgcggaaatatggactcaggagatttctgttcgttgaccgttataccgg |
122 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34460703 |
cgtttcaggcgagtctcgctgctgtttcattgctctgtctttcccactgtttgcggaaatatggactcaggagatttctgttcgttgaccgttataccgg |
34460604 |
T |
 |
| Q |
123 |
acatattgctgcctttcatcgtgattatgttaaccagatttcggtaagccaatcatcattttccacgttcatgccaaattgtcttgttgcttatttagat |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
34460603 |
acatattgctgcctttcatcgtgattatgttaaccagatttcggtaagccaatcatcatttgccacgttcatgccaaattgtcttgtttcttatttagat |
34460504 |
T |
 |
| Q |
223 |
tcaaatatggaaatgtttttgttatttcacc----------ttactatatatgtcttgtgctaaaaaa |
280 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34460503 |
tcaaatatggaaatgtttttattatttcacctatttagggtttactatatatgtcttgtgctaaaaaa |
34460436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University