View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19858_low_14 (Length: 253)
Name: NF19858_low_14
Description: NF19858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19858_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 18 - 209
Target Start/End: Original strand, 14697798 - 14697990
Alignment:
| Q |
18 |
attttcacaccttccagagcatgtataggtcagaatttgattcaggaaaacctaggcccatatgaaatgaatttgactctgtgatattaatcagtgtata |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14697798 |
attttcacaccttccagagcatgtataggtcagaatttgattcaggaaaacctagacccatatgaaatgaatttgactctgtgatattaatcagtgtata |
14697897 |
T |
 |
| Q |
118 |
ctgtataccatgaccatatgttgatggtctgacggattcagaggtctatagtat-ctataaatattttgactaaaataaaaagcacatcgtta |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
14697898 |
ctgtataccatgaccatatgttgatggtctgacggattcagaggtctatagtatactataaatattttgactaaaataaaaagaacaccgtta |
14697990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University