View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19859_high_6 (Length: 309)
Name: NF19859_high_6
Description: NF19859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19859_high_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 186
Target Start/End: Original strand, 2425524 - 2425709
Alignment:
| Q |
1 |
atagatgaatggtaagagagctttctttagtccactcatgggtgacaataagatttcaattagctgctgactcattcatccaaatgttgagtaaaatata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2425524 |
atagatgaatggtaagagagctttctttagtccactcatgggtgacaataagatttcaattagctgctgactcattcatccaaatgttgagtaaaatata |
2425623 |
T |
|
| Q |
101 |
tagaaacatatactcatcaaatgagtgaatgatgcgggagacaaattgaatcttaagtttcctatacttggactgaagggagctcc |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2425624 |
tagaaacatatactcatcaaatgagtgaatgatgcgggagacaaattgaatcttaagtttcctatacttggactgaagggagctcc |
2425709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 256 - 293
Target Start/End: Original strand, 2425791 - 2425828
Alignment:
| Q |
256 |
actttttcagctatgttcatcttttcagctatggatat |
293 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2425791 |
actttttcagctaggttcatcttttcagctatggatat |
2425828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 93; Significance: 3e-45; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 15 - 186
Target Start/End: Complemental strand, 41702931 - 41702763
Alignment:
| Q |
15 |
agagagctttctttagtccactcatgggtgacaataagatttcaattagctgctgactcattcatccaaatgttgagtaaaatatatagaaacatatact |
114 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||| ||||||||||||||||||||||||||||| ||||||||||||| || |||||| |
|
|
| T |
41702931 |
agagagctttctttagtccactcatgggttgctgtaagattt-aattagctgctgactcattcatccaaatgctgagtaaaatatactcaa--gtatact |
41702835 |
T |
|
| Q |
115 |
catcaaatgagtgaatgatgcgggagacaaattgaatcttaagtttcctatacttggactgaagggagctcc |
186 |
Q |
| |
|
| |||||||||||||||||||||||||||||||| ||||||| ||||| || ||||||||||||||||||| |
|
|
| T |
41702834 |
ctgcaaatgagtgaatgatgcgggagacaaattgagtcttaagcttcctgtatttggactgaagggagctcc |
41702763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University