View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19859_high_9 (Length: 204)

Name: NF19859_high_9
Description: NF19859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19859_high_9
NF19859_high_9
[»] chr1 (1 HSPs)
chr1 (153-186)||(771828-771861)


Alignment Details
Target: chr1 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 153 - 186
Target Start/End: Complemental strand, 771861 - 771828
Alignment:
153 tggttgaaatttatgtgattagaatatgagttat 186  Q
    ||||||||||||||||||||||||||||||||||    
771861 tggttgaaatttatgtgattagaatatgagttat 771828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University