View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1985_high_3 (Length: 210)
Name: NF1985_high_3
Description: NF1985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1985_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 130; Significance: 1e-67; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 15 - 191
Target Start/End: Original strand, 51002916 - 51003097
Alignment:
| Q |
15 |
caaaggatgtaacctaataattggttccaaatgtatgatttctgttttgagcaatcatccaaaaataaaatcagacatagaattcaaaatagggagat-- |
112 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51002916 |
caaaggatgtaacctaatgattggttccaaatgtatgatttctgttttgagcaatcatccaaaaataaaatcagacatagaattcaaaatagggagatat |
51003015 |
T |
 |
| Q |
113 |
---atnnnnnnnnttactgcaacatcaaagcagtgaaaagattacttgttgaagtcataatcaggagtttggaatggctgag |
191 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51003016 |
aaaataaaaaaaactactgcaacatcaaagcagtgaaaagattacttgttgaagtcataatcaggagtttggaatggctgag |
51003097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University