View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19860_high_45 (Length: 290)
Name: NF19860_high_45
Description: NF19860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19860_high_45 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 17 - 270
Target Start/End: Original strand, 5774251 - 5774503
Alignment:
| Q |
17 |
ttgttttcatcaaacttagcaaatagaagcttcattgattgtccacaaggacttgaagcaagaaaatttcgacaaagatggcttctttttacttcagttg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5774251 |
ttgttttcatcaaacttagcaaatagaagcttcattgattgtccacaaggacttgaagcaagaaaatttcgacaaagatggcttctttttacttcagttg |
5774350 |
T |
|
| Q |
117 |
ttgcacaaattgttcttgttgctatagatcccttcttgaaaattattggagatttgttggagtcttggcttaattgtttatcaagtaatggagggctcat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5774351 |
ttgcacaaattgttcttgttgctatagatcccttcttgaaaattattggagacttgttggagtcttggcttaattgtttatcaagtaatggagggctcat |
5774450 |
T |
|
| Q |
217 |
tggactcttcttcaactttcttaaaggtttattccattatcattatcactatca |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
5774451 |
tggactcttcttcaactttcttaaaggtttatt-cattatcattatcactatca |
5774503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University