View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19860_high_50 (Length: 279)
Name: NF19860_high_50
Description: NF19860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19860_high_50 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 103; Significance: 3e-51; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 20 - 180
Target Start/End: Complemental strand, 1918029 - 1917858
Alignment:
| Q |
20 |
aatctgcattgtgtcgtgcatatcttcttcttgatgtcttcctttgcacccttaatgttggacttagnnnnnnnnn-----------ggaagagcaaaga |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
1918029 |
aatctgcattgtgtcgtgcatatcttcttcttgatgtcttcctttgcacccttaatgttggacttatgagtttttttttttttttttggaagagcaaaga |
1917930 |
T |
|
| Q |
109 |
caaatattattgcattgaaacacaacacaagtacaagatatactctgtgtgtgaaaatagatacaggaagtg |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1917929 |
caaatattattgcattgaaacacaacacaagtacaagatatactctgtgtgtgaaaatagatacaggaagtg |
1917858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 59; Significance: 5e-25; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 98 - 180
Target Start/End: Complemental strand, 32252633 - 32252551
Alignment:
| Q |
98 |
aagagcaaagacaaatattattgcattgaaacacaacacaagtacaagatatactctgtgtgtgaaaatagatacaggaagtg |
180 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| ||||| |||||| ||||||||||||||||||||| ||||| |
|
|
| T |
32252633 |
aagagcaaagacaaatattattgcattaaaacacaacacaaatacaatgtatactttgtgtgtgaaaatagatacagaaagtg |
32252551 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 47; Significance: 7e-18; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 97 - 180
Target Start/End: Complemental strand, 44516285 - 44516194
Alignment:
| Q |
97 |
gaagagcaaagacaaatattattgcattgaaacacaacacaagta--------caagatatactctgtgtgtgaaaatagatacaggaagtg |
180 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||||||||||| |||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
44516285 |
gaagagcaaagacaaattttattgaattgaaacacaacacaagtacaagtgtacaaggtatactttgtgtgtgaaaatagatacaggaagtg |
44516194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University