View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19860_high_53 (Length: 269)
Name: NF19860_high_53
Description: NF19860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19860_high_53 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 12 - 269
Target Start/End: Complemental strand, 52584273 - 52584016
Alignment:
| Q |
12 |
aacctgtggtggagaatctaacaagtgattattttttcagtggtggaagtggaacttttgcttcaggttctaataataataactcattattattgaaccg |
111 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52584273 |
aacctgtggtggagaatctaactagtgattattttttcagtggtggaagtggaacttttgcttcaggttctaataataataactcattattattgaaccg |
52584174 |
T |
|
| Q |
112 |
ttctacttctacttcttatggaagtgagagttttggttccgttattgggaactctagataccttaaaccagtacagtcacttcttgaagatcttgttgat |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52584173 |
ttctacttctacttcttatggaagtgagagttttggttctgttattgggaactctagataccttaaaccagtacagtcacttcttgaagatcttgttgat |
52584074 |
T |
|
| Q |
212 |
gttggtggaaatgtgattgatagaatgaatgaaaaatatgctgagaagttgtttcatg |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52584073 |
gttggtggaaatgtgattgatagaatgaatgaaaaatatgctgagaagttgtttcatg |
52584016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University