View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19860_high_61 (Length: 242)
Name: NF19860_high_61
Description: NF19860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19860_high_61 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 3 - 242
Target Start/End: Original strand, 54972806 - 54973045
Alignment:
| Q |
3 |
cataggatcaaactataagcaactactatgcttataatgaatggaacaattgagaaaatggtgaaagaataagaaaagaaaaacttacagcaggctttgc |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54972806 |
cataggatcaaactataagcaactactatgcttataatgaatggaacaattgagaaaatggtgaaagaataagaaaagaaaaacttacagcaggctttgc |
54972905 |
T |
 |
| Q |
103 |
tcgtcgcttagttaaagggaagagacgggttccagctcctccaccaagtataaccgccacaactgtacttggatcccttttttccacatctgcatttttc |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54972906 |
tcgtcgcttagttaaagggaagagacgggttccagctcctccaccaagtataaccgccacaactgtacttggatcccttttttccacatctgcatttttc |
54973005 |
T |
 |
| Q |
203 |
aactgcactatcccatatccccattcatcatatcgaaaca |
242 |
Q |
| |
|
|||||||||||||||||| | |||||||||||| |||||| |
|
|
| T |
54973006 |
aactgcactatcccatattcacattcatcatatggaaaca |
54973045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University