View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19860_high_62 (Length: 241)
Name: NF19860_high_62
Description: NF19860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19860_high_62 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 190
Target Start/End: Original strand, 33462571 - 33462760
Alignment:
| Q |
1 |
ttgctaagacttaggactctttcaattcaaacattggaatgccaagtggattttatatcataatcttttatctttttgctttaggaatatcaaatgccgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
33462571 |
ttgctaagacttaggactctttcaattcaaacattggaatgccaagtggattttatatcataatcgtttatctttttgctttaggaatatcaaatgccgt |
33462670 |
T |
 |
| Q |
101 |
ctgattaatcacgacttaattactaattaattgcttttggccgtcttcataattttctattctttagactgttacccttgcttgagtatc |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33462671 |
ctgattaatcacgacttaattactaattaattgcttttcgccgtcttcataattttctattctttagactgttatccttgcttgagtatc |
33462760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University