View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19860_low_13 (Length: 481)
Name: NF19860_low_13
Description: NF19860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19860_low_13 |
 | |
|
| [»] scaffold0290 (2 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 96; Significance: 7e-47; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 96; E-Value: 7e-47
Query Start/End: Original strand, 357 - 460
Target Start/End: Complemental strand, 22829045 - 22828942
Alignment:
| Q |
357 |
aacattgagccttaatgcaagcctaatccttctattttcttccctctctctgtcgagttcccaccttcctcccttctttgataatttgaagaatttataa |
456 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | || |
|
|
| T |
22829045 |
aacattgagccttaatgcaagcctaatccttctattttcttccctctctctgtcgagttcccaccttcctcccttctttgataatttgaagaattgaaaa |
22828946 |
T |
|
| Q |
457 |
gcaa |
460 |
Q |
| |
|
|||| |
|
|
| T |
22828945 |
gcaa |
22828942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 68; Significance: 4e-30; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 1 - 108
Target Start/End: Complemental strand, 24134121 - 24134014
Alignment:
| Q |
1 |
acatgtgctggtatggctgctttcgtgttagggaaacaactttgtaatatcccattcatcagttattggagatttttcagtcgaacgtttccaaaggcga |
100 |
Q |
| |
|
||||||| | ||| |||||||||| || |||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24134121 |
acatgtgttcgtaaggctgctttcatgctagggaaacaactttgtaatataccacccatcagttattggagatttttcagtcgaacgtttccaagggcga |
24134022 |
T |
|
| Q |
101 |
atgtaagt |
108 |
Q |
| |
|
||| |||| |
|
|
| T |
24134021 |
atgcaagt |
24134014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 24134355 - 24134314
Alignment:
| Q |
1 |
acatgtgctggtatggctgctttcgtgttagggaaacaactt |
42 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
24134355 |
acatgtgctggtatggctgctttggtgttaaggaaacaactt |
24134314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 24136669 - 24136628
Alignment:
| Q |
1 |
acatgtgctggtatggctgctttcgtgttagggaaacaactt |
42 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
24136669 |
acatgtgctggtatggctgctttggtgttagggaaacgactt |
24136628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 45149234 - 45149272
Alignment:
| Q |
1 |
acatgtgctggtatggctgctttcgtgttagggaaacaa |
39 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45149234 |
acatgtgctggtatggctgctttggtgttagggaaacaa |
45149272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0290 (Bit Score: 32; Significance: 0.00000001; HSPs: 2)
Name: scaffold0290
Description:
Target: scaffold0290; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 171 - 210
Target Start/End: Original strand, 4256 - 4295
Alignment:
| Q |
171 |
agtgtcagaataagaacgattaagacgaagggtattttgg |
210 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
4256 |
agtgtcaaaataagaacggttaagacgaagggtattttgg |
4295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0290; HSP #2
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 209
Target Start/End: Original strand, 1521 - 1557
Alignment:
| Q |
173 |
tgtcagaataagaacgattaagacgaagggtattttg |
209 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||| |
|
|
| T |
1521 |
tgtcaaaagaagaacgattaagacgaagggtattttg |
1557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University