View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19860_low_35 (Length: 340)
Name: NF19860_low_35
Description: NF19860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19860_low_35 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 114; Significance: 9e-58; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 114; E-Value: 9e-58
Query Start/End: Original strand, 42 - 167
Target Start/End: Complemental strand, 18260532 - 18260407
Alignment:
| Q |
42 |
tttgactcatctaagactgtcctgattttactgtatcataaatattgcagtcaatctttttgtagtttatacatcatcgtggaagaaaatttataactgt |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
18260532 |
tttgactcatctaagactgtcctgattttactgtatcataaatcttgcagtcaatctttttctagtttatacatcatcttggaagaaaatttataactgt |
18260433 |
T |
 |
| Q |
142 |
gcaaatacaaattttaacttgtgggt |
167 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
18260432 |
gcaaatacaaattttaacttgtgggt |
18260407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 18260592 - 18260551
Alignment:
| Q |
1 |
tctgtttgcaatacgtatgtatgaactactcttcttagactt |
42 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18260592 |
tctgtttgcaatacgtatgtatgaactactcttcttagactt |
18260551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 310 - 339
Target Start/End: Complemental strand, 34383939 - 34383910
Alignment:
| Q |
310 |
attttattatgagaaatgatatttgaacat |
339 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
34383939 |
attttattatgagaaatgatatttgaacat |
34383910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University