View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19860_low_46 (Length: 288)
Name: NF19860_low_46
Description: NF19860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19860_low_46 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 1 - 288
Target Start/End: Original strand, 34867543 - 34867833
Alignment:
| Q |
1 |
ctgcccaacgaccttagatattgaaacaaaatcttcattcagaataagataaagtgaaagcaataactagtgagtgaatcaggtgtgtgattgagtggta |
100 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34867543 |
ctgcccaacgacctttgatagcgaaacaaaatcttcattcagaataagataaagtgaaagcaataactagtgagtgaatcaggtgtgtgattgagtggta |
34867642 |
T |
 |
| Q |
101 |
ggggatgtttgtcaaatgttatgattgcatcaacctagtccgctaggttaacattatttcaaaatgatcacgctataattgtaaattattatccaggttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34867643 |
ggggatgtttgtcaaatgttatgattgcatcaacctagtccgctaggttaacattatttcaaaatgatcacgctataattgtaaattattatccaggttt |
34867742 |
T |
 |
| Q |
201 |
catccctccatcaatatttacaaggactagacat---taagttaaaaacatcagagatgatgtatttgaaattaagtgatcaagtctgata |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
34867743 |
catccctccatcaatatttacaaggactagacattaataagttaaaatcatcagagatgatgtatttgaaattaagtgatcatgtctgata |
34867833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University