View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19860_low_51 (Length: 271)
Name: NF19860_low_51
Description: NF19860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19860_low_51 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 252
Target Start/End: Complemental strand, 34085513 - 34085248
Alignment:
| Q |
1 |
atctatacctctcacgtatacccttattcctctcataaccaaaaccata--------------attatgtctttcaatttcaataagagaagcctcgtca |
86 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34085513 |
atctatacctctcacgtatacccttattcctctcataaccaaaaccatagtcatagtcctttaattatgtctttcaatttcaataagagaagcctcgtca |
34085414 |
T |
 |
| Q |
87 |
aaacccttttctcctctaacaaaacctgtggttgcatcaaaataaaaccctctaacgtacttgaaccctctcaaaaacctaaaatctcctttaaccaaaa |
186 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34085413 |
aaacccttttctcctctaacaaaagctgtggttgcatcaaaataaaaccctctaacgtacttgaaccctctcaaaaacctaaaatctcctttaaccaaaa |
34085314 |
T |
 |
| Q |
187 |
cacaaaccctaataccctcacttctcccaccacttcccacgacgccaacaccggtgacaaagattt |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34085313 |
cacaaaccctaataccctcacttctcccaccacttcccacgacgccaacacccatgacaaagattt |
34085248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University