View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19860_low_56 (Length: 253)
Name: NF19860_low_56
Description: NF19860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19860_low_56 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 9877427 - 9877190
Alignment:
| Q |
1 |
agagactaaaaatgtaattttgcccatnnnnnnntatagagatctctataatctttatcttgcaatcgtaaatacagtaactataggagatctagagttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
9877427 |
agagactaaaaatgtaattttgcccataaaaaaatatagagatctctataatctttatcttgcaatcgtaaatacagtaaccataggagatctagagttt |
9877328 |
T |
|
| Q |
101 |
aaatcttcgtatctaacatatataatccctaacattttttctatnnnnnnntgcattaagagaaggttaagtaagggttaactaggtggttaatataatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9877327 |
aaatcttcgtatctaacatatataatccctaacattttttctataaaaaaatgcattaagagaaggttaagtaagggttaactaggtggttaatataatt |
9877228 |
T |
|
| Q |
201 |
aactaatcagctgaattgaaagatttagctatggattt |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9877227 |
aactaatcagctgaattgaaagatttagctatggattt |
9877190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University