View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19860_low_57 (Length: 253)
Name: NF19860_low_57
Description: NF19860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19860_low_57 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 52 - 253
Target Start/End: Original strand, 27868181 - 27868382
Alignment:
| Q |
52 |
atttatgaatttcagtgaattacatggcatcatcctaaatcacgatacgtccaccttttccgatgtattgcactgtgaatggtgtgtaccattatttctt |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
27868181 |
atttatgaatttcagtgaattacatggcatcatcctaaatcacgatacgtctaccttttccgatgtattgcaccgtgaatggtgtgtaccattatttctt |
27868280 |
T |
|
| Q |
152 |
cttagattaagtaggaggatataacctgttaggatttcaaagcattcccttatctcaggcttcaaagtctggtctttcttcaaaagttcctttagcccta |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27868281 |
cttagattaagtaggaggatataacctgttaggatttcaaagcattcccttatctcaggcttcaaagtctggtctttcttcaaaagttcctttagcccta |
27868380 |
T |
|
| Q |
252 |
gc |
253 |
Q |
| |
|
|| |
|
|
| T |
27868381 |
gc |
27868382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 138 - 217
Target Start/End: Complemental strand, 19709034 - 19708955
Alignment:
| Q |
138 |
taccattatttcttcttagattaagtaggaggatataacctgttaggatttcaaagcattcccttatctcaggcttcaaa |
217 |
Q |
| |
|
||||||| |||||||||||||| ||||| |||||| ||||||| ||||| | ||||||| ||||||||| |||||||| |
|
|
| T |
19709034 |
taccattctttcttcttagattgagtagaaggatagaacctgtaaggatattgaagcattaccttatctcttgcttcaaa |
19708955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University