View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19860_low_62 (Length: 241)
Name: NF19860_low_62
Description: NF19860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19860_low_62 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 12 - 241
Target Start/End: Complemental strand, 12638609 - 12638383
Alignment:
| Q |
12 |
aacctgtgtgggttttggtccatcaaatggcaacaacactaaaagaaaacagaaggggcaaagagatagagcttcttctataattcggcgtaatccggtt |
111 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
12638609 |
aaccggtgtgggttttggtccatcaaatggcaacaacactaaaaggaaacagaaggggcaaagagatagagcttcc---ataattcggcgtaatccggtt |
12638513 |
T |
|
| Q |
112 |
gaaaaacctgctttcgtttcggatcaattacaacaacaaccacaagttcaagaagagagtgttgttgaaaaaggtttcattcttgcgtggcttggttttg |
211 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12638512 |
gaaaaacctgctttcgtttcggaacaattacaacaacaaccacaagttcaagaagagagtgctgttgaaaaaggtttcattcttgcgtggcttggttttg |
12638413 |
T |
|
| Q |
212 |
gttcagttattcttgttgagggtattgctc |
241 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |
|
|
| T |
12638412 |
gttcggttattcttgttgagggtattgctc |
12638383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University