View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19860_low_66 (Length: 235)
Name: NF19860_low_66
Description: NF19860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19860_low_66 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 19 - 235
Target Start/End: Original strand, 38574742 - 38574958
Alignment:
| Q |
19 |
aatggtgcaccttgtgatggagatgtactaactgatgtcactagatacagtgaaatgatcatcaatccagaaactccagcttggtgtagccctacaggtt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38574742 |
aatggtgcaccttgtgatggagatgtactaactgatgtcactagatacagtgaaatgatcatcaatccagaaactccagcttggtgtagccctacaggtt |
38574841 |
T |
|
| Q |
119 |
taggaaattgtccaccatttcatatcacaccagataacaaaaagatattcagaaatgacactaccaatttcccttattcagcttatcactattactgtgc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38574842 |
taggaaattgtccaccatttcatatcacaccagataacaaaaagatattcagaaatgacactgccaatttcccttattcagcttatcactattactgtgc |
38574941 |
T |
|
| Q |
219 |
tccaggcaatgctcaac |
235 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
38574942 |
tccaggcaatgctcaac |
38574958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University