View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19860_low_71 (Length: 220)
Name: NF19860_low_71
Description: NF19860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19860_low_71 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 10675754 - 10675974
Alignment:
| Q |
1 |
atgcatgtgggtggtcagtgaactcaagtgtgtgagaaggagataaagattattagttttgtttgtgtgaacagaatgtcctctatgcgcaactgcaaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
10675754 |
atgcatgtgggtggtcagtgaactcaagtgtgtgagaaggggataaagattgttagttttgtttgtgtgaacggaatgtcctctatgcgcaactgtaaag |
10675853 |
T |
 |
| Q |
101 |
actaatctctctaatcgggtaagactgtaataaatgacaaaactcaccct-aaaaaatttaacattattacatagactaatctcttaaactatgtgtcat |
199 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10675854 |
actaatctctctaatcgggtaagactgcaataaatgacaaaactctccctaaaaaaatttaacattattacatagactaatctcttaaactatgcgtcat |
10675953 |
T |
 |
| Q |
200 |
tttattttatcaatgaagcac |
220 |
Q |
| |
|
|||||||||||||| |||||| |
|
|
| T |
10675954 |
tttattttatcaataaagcac |
10675974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University