View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19862_high_9 (Length: 260)
Name: NF19862_high_9
Description: NF19862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19862_high_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 231; Significance: 1e-127; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 16 - 250
Target Start/End: Original strand, 298678 - 298912
Alignment:
| Q |
16 |
cagaatttaaggattggcaaagcatgtatgaagaggccggaacttcattgattgaccgagctacaaaactacgtcaaagaacagcacatgtagaatgcaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
298678 |
cagaatttaaggattggcaaagcatgtatgaagaggccggaacttcattgattgaccgagctacaaaactacgtcaaagaacagcacatgtagaatgcaa |
298777 |
T |
 |
| Q |
116 |
accaaacctacttggagcaactagagttgagaggacaagctgcaagagggagaaacagaagccattgagtctctacggttagctggaattaaggtctggt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
298778 |
accaaacctacttggagcaactagagttgagaggacaagctgcaagagggagaaacagaagccattgagtctctacggctagctggaattaaggtctggt |
298877 |
T |
 |
| Q |
216 |
gataagctagagactgcaatttcaattggtctgtg |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
298878 |
gataagctagagactgcaatttcaattggtctgtg |
298912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 16 - 165
Target Start/End: Original strand, 300887 - 301034
Alignment:
| Q |
16 |
cagaatttaaggattggcaaagcatgtatgaagaggccggaacttcattgattgaccgagctacaaaactacgtcaaagaacagcacatgtagaatgcaa |
115 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| | |||||||||||| ||| | || ||||||||| ||||| ||| | |||||||| ||| |
|
|
| T |
300887 |
cagaatttaaggattggcaaagcatttatgaagagggaagcacttcattgattaaccaaactgcaaaactacctcaaaaggaagcgcttgtagaattcaa |
300986 |
T |
 |
| Q |
116 |
accaaacctacttggagcaactagagttgagaggacaagctgcaagaggg |
165 |
Q |
| |
|
|| |||||||||||| |||||| ||||| ||||||||| |||||||||| |
|
|
| T |
300987 |
actaaacctacttggggcaactggagtt--gaggacaagatgcaagaggg |
301034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 213 - 247
Target Start/End: Original strand, 301033 - 301067
Alignment:
| Q |
213 |
ggtgataagctagagactgcaatttcaattggtct |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
301033 |
ggtgataagctagagactgcaatttcaattggtct |
301067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 81 - 214
Target Start/End: Complemental strand, 27465609 - 27465478
Alignment:
| Q |
81 |
aaactacgtcaaagaacagcacatgtagaatgcaaaccaaacctacttggagcaactagagttgagaggacaagctgcaagagggagaaacagaagccat |
180 |
Q |
| |
|
||||||||||||| | |||| | | |||||||||| ||| ||||||||||||||| || ||||| ||||||||||||||||| | | |||||||||| |
|
|
| T |
27465609 |
aaactacgtcaaacagcagctcttatagaatgcaatttaaatctacttggagcaactggaattgag--gacaagctgcaagagggtgtaccagaagccat |
27465512 |
T |
 |
| Q |
181 |
tgagtctctacggttagctggaattaaggtctgg |
214 |
Q |
| |
|
|||||| |||||| ||||||||| ||||||||| |
|
|
| T |
27465511 |
tgagtccctacggcaagctggaatcaaggtctgg |
27465478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University