View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19863_high_23 (Length: 296)
Name: NF19863_high_23
Description: NF19863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19863_high_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 134; Significance: 9e-70; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 134; E-Value: 9e-70
Query Start/End: Original strand, 1 - 134
Target Start/End: Original strand, 42884891 - 42885024
Alignment:
| Q |
1 |
ttttggggaattattgaacagacatgatgtgatgtatatatagatgataattttgaaacaaccctttgaaatcttatcgtgctttacacattatacatgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42884891 |
ttttggggaattattgaacagacatgatgtgatgtatatatagatgataattttgaaacaaccctttgaaatcttatcgtgctttacacattatacatgt |
42884990 |
T |
 |
| Q |
101 |
actgttgcagagtatattgatgcatttggttata |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
42884991 |
actgttgcagagtatattgatgcatttggttata |
42885024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 162 - 286
Target Start/End: Original strand, 42885466 - 42885590
Alignment:
| Q |
162 |
ctataaacgttgttcatcacattaatgaataacaacaaatgaataatggtcggttttgattatgagtgactgagcaaatgagatttagataaaacaggag |
261 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42885466 |
ctataaacgttattcatcacattaacgaataacaacaaatgaataatggtcggttttgattatgagtgactgagcaaatgagatttagataaaacaggag |
42885565 |
T |
 |
| Q |
262 |
ctatctgttttttctgcctcttcat |
286 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
42885566 |
ctatctgttttttctgcctcttcat |
42885590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University