View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19863_high_31 (Length: 255)
Name: NF19863_high_31
Description: NF19863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19863_high_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 3e-57; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 1 - 113
Target Start/End: Original strand, 37002095 - 37002207
Alignment:
| Q |
1 |
agagcaagaagaggcctagaaagaaatgaaggaaataaaagaagggtagtgttgattagcatgcaatgaaacggagatgaaaaggatcaagaagaacaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37002095 |
agagcaagaagaggcctagaaagaaatgaaggaaataaaagaagggtagtgttgattagcatgcaatgaaacggagatgaaaaggatcaagaagaacaaa |
37002194 |
T |
 |
| Q |
101 |
ccattatactact |
113 |
Q |
| |
|
||||||||||||| |
|
|
| T |
37002195 |
ccattatactact |
37002207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 105 - 180
Target Start/End: Original strand, 37002400 - 37002475
Alignment:
| Q |
105 |
tatactactttgtagtttatacatgaaactgataatgtgaagatatatgagaaaacataagtgtatttattttttc |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37002400 |
tatactactttgtagtttatacatgaaactgataatgtgaagatatatgagaaaacataagtgtatttattttttc |
37002475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 86 - 115
Target Start/End: Original strand, 36989244 - 36989273
Alignment:
| Q |
86 |
atcaagaagaacaaaccattatactacttt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
36989244 |
atcaagaagaacaaaccattatactacttt |
36989273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 28 - 65
Target Start/End: Original strand, 36998217 - 36998254
Alignment:
| Q |
28 |
gaaggaaataaaagaagggtagtgttgattagcatgca |
65 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
36998217 |
gaaggaaataaaagaagggtaacgttgattagcatgca |
36998254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University