View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19863_high_43 (Length: 226)
Name: NF19863_high_43
Description: NF19863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19863_high_43 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 3e-81; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 18 - 191
Target Start/End: Complemental strand, 37789076 - 37788899
Alignment:
| Q |
18 |
tcttatatgaaggaaggatcttatacagctgttgttgttggttccttcatatgtaaaacatatcgat----gaatgaaaagttgaagaatagttgcatac |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
37789076 |
tcttatatgaaggaaggatcttatacagctgttgttgttggttccttcatatgtaaaacatatcgatcgatgcatgaaaagttgaagaatagttgcatac |
37788977 |
T |
 |
| Q |
114 |
ccaaacaatccgcatagaaatgctagagaaagcacattccgagtaatctttggtctttccttcctgcataacagaaag |
191 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37788976 |
ccaaacaatccgcatagaaatgccagagaaagcacattccgagtaatctttggtctttccttcctgcataacagaaag |
37788899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 111 - 169
Target Start/End: Complemental strand, 37807398 - 37807340
Alignment:
| Q |
111 |
tacccaaacaatccgcatagaaatgctagagaaagcacattccgagtaatctttggtct |
169 |
Q |
| |
|
|||||||||||||| |||||||||| ||| |||| || |||| ||||||||||||||| |
|
|
| T |
37807398 |
tacccaaacaatccacatagaaatgaaagaaaaagaaccttccaagtaatctttggtct |
37807340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 110 - 183
Target Start/End: Complemental strand, 37797209 - 37797136
Alignment:
| Q |
110 |
atacccaaacaatccgcatagaaatgctagagaaagcacattccgagtaatctttggtctttccttcctgcata |
183 |
Q |
| |
|
|||||||||||| || |||| ||||| | | ||||||| |||| ||||||||||||||||| | ||||||||| |
|
|
| T |
37797209 |
atacccaaacaacccagataggaatgccataaaaagcaccttccaagtaatctttggtcttttcctcctgcata |
37797136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University