View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19863_low_22 (Length: 307)
Name: NF19863_low_22
Description: NF19863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19863_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 33 - 291
Target Start/End: Original strand, 6803318 - 6803576
Alignment:
| Q |
33 |
caagactaaataatatcgtatcagtggtgtctgttttggtattagtagttaatggttgtttcattaagattagagattagacactagacagattttagct |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6803318 |
caagactaaataatatcgtatcagtggtgtctgttttggtattggtagttaatggttgtttcattaagattagagattagacactagacagattttagct |
6803417 |
T |
 |
| Q |
133 |
actggagacaaggcactgaatctagatagtcagcttcaaattgcaatgcttaatggcttcatagaaaatccgtttgttatgaaacaatttagattatcaa |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6803418 |
actggagacaaggcactgaatctagatagtcagcttcaaattgcaatgcttaatggcttcatagaaaatccgtttgttatgaaacaatttagattatcaa |
6803517 |
T |
 |
| Q |
233 |
atagtattgagtattgactannnnnnnnnngaattacagtacaaggaaacacaaaaaca |
291 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6803518 |
atagtattgagtattgactattttttttttgaattacagtacaaggaaacacaaaaaca |
6803576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University