View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19863_low_23 (Length: 302)
Name: NF19863_low_23
Description: NF19863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19863_low_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 11 - 284
Target Start/End: Original strand, 38462082 - 38462347
Alignment:
| Q |
11 |
attattcttgtgtgatgttatataaacttttatcatatagatcatcgttaaagttttaaaacgattttcaaatattatatgaaatgcttttccacaagaa |
110 |
Q |
| |
|
||||||||||||||||| |||| ||||||||| |||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| | |
|
|
| T |
38462082 |
attattcttgtgtgatgctata--aacttttattatatagatcatcgttaaagttttaaa-caattttcaaatattatatgaaatgcttttccacaagga |
38462178 |
T |
 |
| Q |
111 |
gcaaccaattttannnnnnnnactgaaaatatagaaatttgctcataattttgtgctaagaagaatgacacatcacattcgacatatgagttggtagttg |
210 |
Q |
| |
|
||| |||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38462179 |
gcagccaatttt-----ttttactaaaaatatagaaatttgctcataattttgtgctaagaagaatgacacatcacattcgacatatgagttggtagttg |
38462273 |
T |
 |
| Q |
211 |
cagagcaagtatggaataaattagcacttttgtaatattgcaatgtgaatgtcacatgatattgacatcctaat |
284 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||| |||| |||||||||||| ||| |||| ||||| |
|
|
| T |
38462274 |
cagagcaagtatgaaatacattagcacttttgtaatattgggatgtcaatgtcacatgacattaacattctaat |
38462347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University