View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19863_low_27 (Length: 276)
Name: NF19863_low_27
Description: NF19863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19863_low_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 18 - 265
Target Start/End: Original strand, 9379104 - 9379353
Alignment:
| Q |
18 |
ttttgcacaacaatgtgtggcatgatagaaatgattttta-cctaactgtatatttttctagaaatagcaacttaattgattggtcaccnnnnnnnctat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9379104 |
ttttgcacaacaatgtgtggcatgatagaaatgatttttaacctaactgtatatttttctagaaatagcaacttaattgattggtcacctttttttctat |
9379203 |
T |
 |
| Q |
117 |
aaagattgatcactttatatcacgtttttcatgctgaataggatgtctccaaaattaaacgttagtatttgctaggaataaatcctcaagctttttaaca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9379204 |
aaagattgatcactttatatcacgtttttcatgctgaataggatgtctccaaaattaaacgttagtatttgctaggaataaatcctcaagctttgtaaca |
9379303 |
T |
 |
| Q |
217 |
tcccac-ttttttatcaagtcagctctcatttttctctaacatgagaatt |
265 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9379304 |
tcccactttttttatcaagtcagctctcatttttctctaacatgagaatt |
9379353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University