View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19863_low_34 (Length: 253)

Name: NF19863_low_34
Description: NF19863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19863_low_34
NF19863_low_34
[»] chr3 (1 HSPs)
chr3 (75-113)||(19136874-19136912)


Alignment Details
Target: chr3 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 75 - 113
Target Start/End: Complemental strand, 19136912 - 19136874
Alignment:
75 ttgtaatatctagcttggtacaagaattatttgagttag 113  Q
    |||||||||||||||||||||||||||||||||||||||    
19136912 ttgtaatatctagcttggtacaagaattatttgagttag 19136874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University