View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19863_low_37 (Length: 250)
Name: NF19863_low_37
Description: NF19863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19863_low_37 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 20 - 250
Target Start/End: Complemental strand, 19137264 - 19137021
Alignment:
| Q |
20 |
gaagaattagatcaactctatggtgcataaacaaaataactcttgcaccatacacaaacttgtttccccattttattattaaatt-------------ga |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
19137264 |
gaagaattagatcaactctatggtgcataaacaaaataactcttgcaccatacacaaacttgtttccccattttattattaaatttcactattaaattga |
19137165 |
T |
 |
| Q |
107 |
aaataaaatatgatgagatttatcatccaagggtagaaaatagattgtgcataatgcaagaatgatttgcttgtgcatgttagacaaaaccctagaatta |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19137164 |
aaataaaatatgatgagatttatcatccaagggtagaaaatagattgtgcataatgcaagaatgatttgcttgtgcatgttagacaaaaccctagaatta |
19137065 |
T |
 |
| Q |
207 |
atatacaatcaacaatatgacaataattctaggcatttgatata |
250 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
19137064 |
atatacaatcaacaatatgacaattattcaaggcatttgatata |
19137021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University