View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19863_low_38 (Length: 245)
Name: NF19863_low_38
Description: NF19863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19863_low_38 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 19 - 234
Target Start/End: Complemental strand, 42190091 - 42189880
Alignment:
| Q |
19 |
ctattgctgcttatattggttcctccacttgcatccaagtttaatttcacctgttgggattgatggtgaagtataatttctacatcagatttgagattta |
118 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
42190091 |
ctattgctgcttatattggttcttccacttgcatccaagtttaatttcacctattgggattgatgatgaagtataatttctacatcagatttgagattta |
42189992 |
T |
|
| Q |
119 |
actatttaagccaaaatttaactaaatcgacagattcagattggaccgataatctatgtatgtacgtacctggtgtgtgaaaggaccattaatttggagt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
42189991 |
actatttaagccaaaatttaactaaatcgacagattcagattggaccgataatctatgtatgtacgtacctggtgtgtgaaaggacc----atttggagt |
42189896 |
T |
|
| Q |
219 |
atgaaggacaaccttt |
234 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
42189895 |
atgaaggacaaccttt |
42189880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 150 - 235
Target Start/End: Original strand, 19533328 - 19533409
Alignment:
| Q |
150 |
agattcagattggaccgataatctatgtatgtacgtacctggtgtgtgaaaggaccattaatttggagtatgaaggacaacctttg |
235 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||||||| |||||||||||||| |||||||||| ||||||| ||||||| |
|
|
| T |
19533328 |
agattcagattggatcgataatttatgtatgtacgtacctgttgtgtgaaaggacc----atttggagtacgaaggacgacctttg |
19533409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University