View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19863_low_45 (Length: 227)
Name: NF19863_low_45
Description: NF19863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19863_low_45 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
| [»] scaffold0311 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 2e-97; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 7 - 227
Target Start/End: Complemental strand, 51376929 - 51376709
Alignment:
| Q |
7 |
gtattagtgttcgcgccaccgaaatagcgccctctatgcgccctgctcctgcgccgcaccaatttttgggatggccgggctgcatttcccctttgacaag |
106 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
51376929 |
gtattagtgttcgcgccaccgaaatagctccctctatgcgccctgctcctgcgccgcaccaatttttgggatggccaggctgcatttcctctttgacaag |
51376830 |
T |
|
| Q |
107 |
ataggagtgtgcccagannnnnnngattggatttgtctccaagcaatcatttctcatattatgaactgaacaaatcaaattttatcttgcatgcggttct |
206 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
51376829 |
ataggagtgtgcccagatttttttgattggatttgtctccaagcaatcatttctcatattatgaactgaacgaatcaaattttatcttgcacgcggttct |
51376730 |
T |
|
| Q |
207 |
taatgaaagttaggagagctt |
227 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
51376729 |
taatgaaagttaggagagctt |
51376709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 162 - 227
Target Start/End: Complemental strand, 51380940 - 51380875
Alignment:
| Q |
162 |
atattatgaactgaacaaatcaaattttatcttgcatgcggttcttaatgaaagttaggagagctt |
227 |
Q |
| |
|
||||||||||||||||| |||||||||| || || ||| |||||||||| || ||||||||||||| |
|
|
| T |
51380940 |
atattatgaactgaacatatcaaattttgtcatggatgtggttcttaataaaggttaggagagctt |
51380875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 28 - 107
Target Start/End: Complemental strand, 26278607 - 26278528
Alignment:
| Q |
28 |
aaatagcgccctctatgcgccctgctcctgcgccgcaccaatttttgggatggccgggctgcatttcccctttgacaaga |
107 |
Q |
| |
|
||||||||||| |||||||||| ||||| ||||| |||||||| ||||| |||||| || |||||||| ||||||||||| |
|
|
| T |
26278607 |
aaatagcgcccgctatgcgccccgctcccgcgccacaccaattcttggggtggccgtgccgcatttccgctttgacaaga |
26278528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 26 - 105
Target Start/End: Original strand, 48197279 - 48197358
Alignment:
| Q |
26 |
cgaaatagcgccctctatgcgccctgctcctgcgccgcaccaatttttgggatggccgggctgcatttcccctttgacaa |
105 |
Q |
| |
|
||||||||||||||||| || ||| ||||| || |||| ||||||||||| |||||| || |||||||| | ||||||| |
|
|
| T |
48197279 |
cgaaatagcgccctctacgccccccgctcccgcaccgcgtcaatttttgggttggccgcgccgcatttccgcattgacaa |
48197358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 8 - 70
Target Start/End: Complemental strand, 9688997 - 9688935
Alignment:
| Q |
8 |
tattagtgttcgcgccaccgaaatagcgccctctatgcgccctgctcctgcgccgcaccaatt |
70 |
Q |
| |
|
|||||||| |||| ||||| ||||||||||| ||| |||||| |||||||| |||| |||||| |
|
|
| T |
9688997 |
tattagtggtcgcaccaccaaaatagcgcccgctacgcgccccgctcctgcaccgcgccaatt |
9688935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 8 - 105
Target Start/End: Complemental strand, 53286029 - 53285932
Alignment:
| Q |
8 |
tattagtgttcgcgccaccgaaatagcgccctctatgcgccctgctcctgcgccgcaccaatttttgggatggccgggctgcatttcccctttgacaa |
105 |
Q |
| |
|
||||||||| ||||| ||||||||||||||| ||| ||| || ||| ||||||| ||||||| ||| |||||||||||||||| | ||||||| |
|
|
| T |
53286029 |
tattagtgtccgcgcaaccgaaatagcgcccgctacgcgtccgcatcccgcgccgcgtcaattttaggggctgccgggctgcatttccgcattgacaa |
53285932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 22 - 94
Target Start/End: Complemental strand, 11992880 - 11992808
Alignment:
| Q |
22 |
ccaccgaaatagcgccctctatgcgccctgctcctgcgccgcaccaatttttgggatggccgggctgcatttc |
94 |
Q |
| |
|
||||||||||||| ||| ||| || ||||||||| || |||| |||||||||||| |||| | || ||||||| |
|
|
| T |
11992880 |
ccaccgaaatagcccccgctacgcaccctgctcccgcaccgcgccaatttttgggttggctgcgccgcatttc |
11992808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0311 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0311
Description:
Target: scaffold0311; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 22 - 83
Target Start/End: Original strand, 1532 - 1593
Alignment:
| Q |
22 |
ccaccgaaatagcgccctctatgcgccctgctcctgcgccgcaccaatttttgggatggccg |
83 |
Q |
| |
|
||||||||||||||||| ||| | ||| |||||||| ||||||||||| ||||| |||||| |
|
|
| T |
1532 |
ccaccgaaatagcgcccgctacacaccccgctcctgcaccgcaccaattattgggttggccg |
1593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 105
Target Start/End: Complemental strand, 33516038 - 33515990
Alignment:
| Q |
57 |
gcgccgcaccaatttttgggatggccgggctgcatttcccctttgacaa |
105 |
Q |
| |
|
|||||||| ||||||||||| |||||| || |||||||| ||||||||| |
|
|
| T |
33516038 |
gcgccgcatcaatttttggggtggccgcgccgcatttccgctttgacaa |
33515990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University