View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19864_low_2 (Length: 309)
Name: NF19864_low_2
Description: NF19864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19864_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 24 - 294
Target Start/End: Complemental strand, 14131854 - 14131584
Alignment:
| Q |
24 |
caagtaaagcttcaagaactacctcaattaggtcacgataaggcacaagatctccaattgacataagagatttggaaattgtgcgaatgcgggcaatgaa |
123 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14131854 |
caagtaaagctacaagaactacctcaattaggtcacgatgaggcacaagatctccaattgacataagagatttggaaattgtgcgaatgcgggcaatgaa |
14131755 |
T |
 |
| Q |
124 |
atcagtgattgaacatgaacttttggtaatggttcgaagctcagttctgagttatctagaacgagttcacatctgcgtaaagcaatgactatgcacgtca |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
14131754 |
atcagtgattgaacatgaacttttggtaatggttcgaagctcagttctgagttatctagaacgagttcacatctgcgtaaagcaataactatgcacgtca |
14131655 |
T |
 |
| Q |
224 |
tcccaaacctgatacgaatgacggaagccaacgaagtgcgaaagtagcgaagatgagatagtggagagaat |
294 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
14131654 |
tcccaaacctgatatgaatgacggaagcgaacgaagtgcgaaagtagcgaagaagagatagtggagagaat |
14131584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University