View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19865_high_15 (Length: 238)
Name: NF19865_high_15
Description: NF19865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19865_high_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 99 - 227
Target Start/End: Original strand, 5574920 - 5575048
Alignment:
| Q |
99 |
atagtatgtgtgttggataaaaagttgtggctaagggataaaatgatatgtagataaatagagaaatttttaatttgatcaaacaacttgttattgctta |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
5574920 |
atagtatgtgtgttggataaaaagttgtggctaagggataaaattatatgtagataaatagagaaatttttaatttgatcaaacaacttgttattgttta |
5575019 |
T |
|
| Q |
199 |
aacacttggcagtgagtcctatttatatt |
227 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
5575020 |
aacacttggcagtgagtcctatttatatt |
5575048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 45 - 81
Target Start/End: Original strand, 5574863 - 5574899
Alignment:
| Q |
45 |
gagggatcatcatcattatagatgtagggtgcgttaa |
81 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5574863 |
gagggatcatcatcattatagatgtagggtgcgttaa |
5574899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University