View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19865_high_15 (Length: 238)

Name: NF19865_high_15
Description: NF19865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19865_high_15
NF19865_high_15
[»] chr1 (2 HSPs)
chr1 (99-227)||(5574920-5575048)
chr1 (45-81)||(5574863-5574899)


Alignment Details
Target: chr1 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 99 - 227
Target Start/End: Original strand, 5574920 - 5575048
Alignment:
99 atagtatgtgtgttggataaaaagttgtggctaagggataaaatgatatgtagataaatagagaaatttttaatttgatcaaacaacttgttattgctta 198  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
5574920 atagtatgtgtgttggataaaaagttgtggctaagggataaaattatatgtagataaatagagaaatttttaatttgatcaaacaacttgttattgttta 5575019  T
199 aacacttggcagtgagtcctatttatatt 227  Q
    |||||||||||||||||||||||||||||    
5575020 aacacttggcagtgagtcctatttatatt 5575048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 45 - 81
Target Start/End: Original strand, 5574863 - 5574899
Alignment:
45 gagggatcatcatcattatagatgtagggtgcgttaa 81  Q
    |||||||||||||||||||||||||||||||||||||    
5574863 gagggatcatcatcattatagatgtagggtgcgttaa 5574899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University