View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19865_low_11 (Length: 293)
Name: NF19865_low_11
Description: NF19865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19865_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 162 - 278
Target Start/End: Original strand, 26252741 - 26252857
Alignment:
| Q |
162 |
tggtgaaatcattagaaccatcttcacttgatccattatgctttccatgattggttcatagtttgaataccatgaaaaaccaaggaatattagaagggta |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
26252741 |
tggtgaaatcattagaaccatcttcacttgatccattatgctttccatgattggttcatagtttgagtaccatgaaaaaccaaggaatattagaagggta |
26252840 |
T |
 |
| Q |
262 |
agtaggaagaaacaaag |
278 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
26252841 |
agtaggaagaaacaaag |
26252857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 17 - 97
Target Start/End: Original strand, 26252596 - 26252676
Alignment:
| Q |
17 |
gaagaacaacaagaaacaaaccaacaccccaaggagttccaccagctctatgaagtgactctctctcaggcaaaggaatca |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26252596 |
gaagaacaacaagaaacaaaccaacaccccaaggagttccaccagctctatgaagtgactctctctcaggcaaaggaatca |
26252676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University