View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19865_low_18 (Length: 233)
Name: NF19865_low_18
Description: NF19865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19865_low_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 151 - 216
Target Start/End: Complemental strand, 14659950 - 14659884
Alignment:
| Q |
151 |
tccatttaaataactcaattatttatcaac-cgtgtaacactatattaattaatgcgcataagtttg |
216 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
14659950 |
tccatttaaataacccaatgatttatcaacgcgtttaacactatattaattaatgcgcataagtttg |
14659884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University