View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19865_low_19 (Length: 219)
Name: NF19865_low_19
Description: NF19865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19865_low_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 13 - 203
Target Start/End: Original strand, 972474 - 972663
Alignment:
| Q |
13 |
agcataggaatatgatctgaagcatatctaagcaagtgattattaaaatgattttggtaatttgaaatccagctactggtggct-aaaaatctatcaagt |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| |||||| |||||||||||| ||||||||||||||| |
|
|
| T |
972474 |
agcataggaatatgatctgaagcatatctaagcaactgattatgaaaatgattttggtaatttgtaatccaactactggtggctaaaaaatctatcaagt |
972573 |
T |
 |
| Q |
112 |
ctctcttggatgtgatgactttcagcctgatttttagcccaagtgaaatgatcccctatgtagcccagatcattaagattgcaagtgtttat |
203 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
972574 |
ctctcttggatgtgatgac--tcagcctgattattagcccaggtgaaatgatcccctatgtagcccatatcattaagattgcaagtgtttat |
972663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University