View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19865_low_20 (Length: 213)

Name: NF19865_low_20
Description: NF19865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19865_low_20
NF19865_low_20
[»] chr7 (1 HSPs)
chr7 (126-190)||(39383295-39383359)


Alignment Details
Target: chr7 (Bit Score: 61; Significance: 2e-26; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 126 - 190
Target Start/End: Original strand, 39383295 - 39383359
Alignment:
126 actaaaaatggtttaaagactctattatattttgatacttgagatcagatttctatatttaagat 190  Q
    |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
39383295 actaaaaatggtttaaagactctattatattttgatacttaagatcagatttctatatttaagat 39383359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University