View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19865_low_8 (Length: 339)
Name: NF19865_low_8
Description: NF19865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19865_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 79 - 323
Target Start/End: Original strand, 3300400 - 3300640
Alignment:
| Q |
79 |
attattagaaagttttcaaccttttgtttttctcattataaatacccattgaggaaaattcttaaagattataactaactttccttcttttttggccaag |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3300400 |
attattagaaagttttcaaccttttgtttttctcattataaatacccattgaggaaaattcttaaagattataac----tttccttcttttttggccaag |
3300495 |
T |
|
| Q |
179 |
tttcaagctttgtgaaaatgggtttgttagagaatttggaatgggtgaatgtttatggaaagaagcgttgtaggagcttgttttggaggatgagggctac |
278 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3300496 |
tttcaagctttgtgaaaatgggtttgttggagaatttggaatgggtgaatgtttatggaaagaagcgttgtaggagcttgttttggaggatgagggctac |
3300595 |
T |
|
| Q |
279 |
attgaagagggctttgaggaatggaaataagcagaggcaaaagtt |
323 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
3300596 |
attgaagagggctttgaggaatgggaataagcagaggcaaaagtt |
3300640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 33 - 61
Target Start/End: Original strand, 3300369 - 3300397
Alignment:
| Q |
33 |
ccctacacgatatacagtgttgttgtttc |
61 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
3300369 |
ccctacacgatatacagtgttgttgtttc |
3300397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University