View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19866_low_24 (Length: 219)
Name: NF19866_low_24
Description: NF19866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19866_low_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 11 - 203
Target Start/End: Complemental strand, 25189118 - 25188928
Alignment:
| Q |
11 |
aagaaaatatatatttgaacaagggctacaagttcctaagggatataaaaggataaagaagaattgagaattttgggagctcacaccttttcatgaaaag |
110 |
Q |
| |
|
||||| |||||||||||||||||||||| | |||||||||||||| ||||||||||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
25189118 |
aagaatatatatatttgaacaagggctaaatgttcctaagggata--aaaggataaagaagaattgagaattgtgggagctcacagcttttcatgaaaag |
25189021 |
T |
|
| Q |
111 |
ataaagaagaattgagaattaaggtgagcttcttaaattaaggtttagttttagtgacatgagggatgaagtaagagcttggttagataaatt |
203 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
25189020 |
ataaagaagaactgagaattaaggtgagcttcttaaattaaggtttagttttagtgacatgagggatgaagtaagagcttggttagagaaatt |
25188928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University