View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19867_low_2 (Length: 343)
Name: NF19867_low_2
Description: NF19867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19867_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 1 - 288
Target Start/End: Complemental strand, 8006831 - 8006544
Alignment:
| Q |
1 |
catcattagatgttgtttattacatccagccatcaaaagagaagtaatttcatttcttaattagaaatttccatttttatgtcagtgactgatataaaaa |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8006831 |
catcattagatgctgtttattacatccagccatcaaaagagaagtaatttcatttcttaattagaaatttccatttttatgtcagtgactgatataaaaa |
8006732 |
T |
 |
| Q |
101 |
taaaacatcaagaagtgctgtttatccatattaagcatctcttttcctagcatgcagtgtggtcatgttcttgtctgatatgtctggaagggagcctcta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8006731 |
taaaacatcaagaagtgctgtttatccatattaagcatttcttttcctagcatgcagtgtggtcatgttcttgtctgatatgtctggaagggagcctcta |
8006632 |
T |
 |
| Q |
201 |
tacaagaagtatgcatagacttttgattttcactaatattgtatcgtttcatcttttatacgtttgggatcatactgattgttgcttc |
288 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8006631 |
tacaagaagtatgcgtagacttttgatttttacaaatattgtatcgtttcatcttttatacgtttgggatcatactgattgttgcttc |
8006544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University