View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19868_high_13 (Length: 293)
Name: NF19868_high_13
Description: NF19868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19868_high_13 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 9 - 293
Target Start/End: Complemental strand, 42393712 - 42393428
Alignment:
| Q |
9 |
acatcatcataaagagacgtctgccctcatcgagcatctttttcaagattttgaagaaaacatcagcagaggactgggatgttccagtattgcttgctat |
108 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42393712 |
acatcatcataaagagacgtctgtcctcatcgagcatctttttcaagattttgaagaaaacatcagcagaggactgggatgttccagtattgcttgctat |
42393613 |
T |
 |
| Q |
109 |
aatatgcgaagatttccccaacattgctttgctatcgggcagataagaaaaacatgcttgcagtcttcaggttcagaatcacatagaatgcaaatatctt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
42393612 |
aatatgcgaagatttccccaacattgctttgctatcgggcagataagaaaaacatgcttgcagtcttcaggttcagaatcacatagaatacaaatatctt |
42393513 |
T |
 |
| Q |
209 |
cacactgaacccgtttattgattagatttccgcgggcaggcaagcaatcatggagggatcaccataggaaggggcggacgcatgt |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42393512 |
cacactgaacccgtttattgattagatttccgcgggtaggcaagcaatcatggagggatcaccataggaaggggcggacgcatgt |
42393428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University