View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19868_high_9 (Length: 340)
Name: NF19868_high_9
Description: NF19868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19868_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 264; Significance: 1e-147; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 1 - 268
Target Start/End: Complemental strand, 39687914 - 39687647
Alignment:
| Q |
1 |
aatgagctaggaaaaagtgatcaaactacatattcttatttatttcagaatatccagaaataaaaatgatagcaataacttcgttatgttaccctgtcgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39687914 |
aatgagctaggaaaaagtgatcaaactacatattcttatttatttcagaatatccagaaataaaaataatagcaataacttcgttatgttaccctgtcgt |
39687815 |
T |
 |
| Q |
101 |
tgtttgattgtacactagttatcgtatgagatttcaaatccgaacaaagcgagtccaaatagtaccacatgatattcaaaaactgagttgcagcttcagc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39687814 |
tgtttgattgtacactagttatcgtatgagatttcaaatccgaacaaagcgagtccaaatagtaccacatgatattcaaaaactgagttgcagcttcagc |
39687715 |
T |
 |
| Q |
201 |
ctgcaacaggtacaaattagcagttgtcactggtgggagaatcatccgaggctagaagctgaaaaatt |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39687714 |
ctgcaacaggtacaaattagcagttgtcactggtgggagaatcatccgaggctagaagctgaaaaatt |
39687647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 297 - 340
Target Start/End: Complemental strand, 39687647 - 39687604
Alignment:
| Q |
297 |
tatttctctaaatttcagaaagagaagaactccagtatgggaac |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39687647 |
tatttctctaaatttcagaaagagaagaactccagtatgggaac |
39687604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University