View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19868_low_13 (Length: 320)
Name: NF19868_low_13
Description: NF19868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19868_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 10 - 303
Target Start/End: Complemental strand, 22789141 - 22788847
Alignment:
| Q |
10 |
gtgagatgaaaaccatataatcaatgttgcggaccatatttttaaaactttgcattgaagtttgctggaacacatggtcaggagatagacttgagaagag |
109 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
22789141 |
gtgatatgaaaaccatataatcaatgttgcggaccatatttttaaaactttgcattgaagtttgctggaacacatggtctggagatagacttgagaagag |
22789042 |
T |
 |
| Q |
110 |
gacacacgagaccatgttagagggactcttcgcacgaccacatatagttgtcaagattgagtttgatgtttacctctttgatttgatgtagctgtctcta |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
22789041 |
gacacacgagaccatgttagagggactcttcgcacgaccacatatagttgtcaagattgagtttgatgtttacctctttgatttgatgtagttgtctcta |
22788942 |
T |
 |
| Q |
210 |
atatgtactaaaatgactcttcattcatcaacttgttcaaatttttatgtgatgtgtgaaggatcaatggtgcct-atcaaaggataagtaatct |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
22788941 |
atatgtactaaaatgactcttcattcatcaagttgttcaaatttttatgtgatgtgtgaaggatcaatggtgcctaatgaaaggataagtaatct |
22788847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University