View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19869_low_16 (Length: 233)
Name: NF19869_low_16
Description: NF19869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19869_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 14 - 215
Target Start/End: Original strand, 13919031 - 13919232
Alignment:
| Q |
14 |
aatatatactttatgatcctttttgcggcctctctctccggtcaaatgtcatcgacttctgacatttgaccagagagctgttatagccgacctttaatcg |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
13919031 |
aatatatactttatgatcctttttgcggcctctctctccggtcaaatgtcatcgactactgacatttgaccagagagctgttatagctgacctttaatcg |
13919130 |
T |
 |
| Q |
114 |
gagggagcataacatattaaatttccatagttttcatataccatttcttcataaatatcatagcatagcatatatattaacatggatgatggatccttta |
213 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13919131 |
gagggagcataacatattaaaattccatagttttcatataccatttcttcataaatatcatagcatagcatatatattaacatggatgatggatccttta |
13919230 |
T |
 |
| Q |
214 |
tg |
215 |
Q |
| |
|
|| |
|
|
| T |
13919231 |
tg |
13919232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University